Journal: bioRxiv

Article Title: The Mechanism of MICU-Dependent Gating of the Mitochondrial Ca 2+ Uniporter

doi: 10.1101/2020.04.04.025833

Figure Lengend Snippet: ( A ) A schematic arrangement of various subunits in the MCU complex. Four MCU and four EMRE subunits form the pore of the MCU complex (only two MCU and two EMRE subunits are shown for simplicity). EMRE also tethers MICU1 subunit to the pore on the cytosolic side of the IMM (i.e., in the mitochondrial intermembrane space, IMS). MICU1 forms homodimers or hetero-dimerizes with MICU2 or MICU3 (not shown). Each MICU subunit has two EF hands that bind cytosolic Ca 2+ . ( B to F ) CRISPR-mediated indels in various MCU subunit genes and the resulting mutant alleles. The CRISPR binding sites (for sgRNA) are highlighted in yellow , and their PAM sequences are highlighted in green . The translational initiation codon (ATG) is shown in bold where applicable. (B) Overview of the MCU gene and indels in the knockout. A sgRNA was used to target exon 3. The sequence of targeted region in MCU gene is shown; exon 3 is underlined. Targeted sequencing indicates frame-shift indels ( red ) in both alleles ( Al- 1 and Al- 2). (C) Overview of the EMRE gene and truncated region in the knockout. Two sgRNAs were used for CRISPR-Cas9–mediated deletion in the exon-2 ( underlined ) and the flanking region. Targeted sequencing indicates same 259-bp deletion ( red ) in both alleles. (D) Overview of the MICU1 gene and truncated region in the knockout. Two sgRNAs were used for CRISPR-Cas9– mediated deletion in the exon-3 ( underlined ) and the flanking region. Targeted sequencing indicates that almost all of exon-3 is deleted along with a portion of the flanking region ( red ) in both alleles ( Al- 1 and A l- 2). (E) Overview of the MICU2 gene and truncated region in the knockout. Two sgRNAs were used for CRISPR-Cas9–mediated deletion in the exon-1 ( underlined ) and the flanking region. Targeted sequencing indicates that almost all of exon-1 is deleted ( red ) in both alleles. (F) Overview of the MICU3 gene and truncated region in the knockout. Two sgRNAs were used for CRISPR-Cas9–mediated deletion in the exon-1 ( underlined ). Targeted sequencing indicates a 73-bp deletion in the expected cut area ( red ) in both alleles.

Article Snippet: MEFs were transfected with the Cas9 gRNA vector (Addgene: PX459) via electroporation (Invitrogen Neon transfection system) using the following parameters: 1×10 6 cells and 1 μg of two different gRNA-Cas9 plasmids.

Techniques: CRISPR, Mutagenesis, Binding Assay, Knock-Out, Sequencing

Journal: Cell host & microbe

Article Title: The Listeriolysin O PEST-like Sequence Co-opts AP-2-Mediated Endocytosis to Prevent Plasma Membrane Damage during Listeria Infection

doi: 10.1016/j.chom.2018.05.006

Figure Lengend Snippet: (A) Schematic diagrams of different baits (LLO truncations) constructs tested in the yeast 2-hybrid assay. (B) Quantification of secreted alpha-galactosidase activity following a GAL4-based two-hybrid interaction in Y2HGold yeast colonies. The results represented the percentage of alpha-galactosidase activity of positive control (p53+ SV40 large T antigen). Bars and error represent mean ± SD of replicate measurements. N=4 biological repeats *** p<0.001 (Student’s t-test). Results shown represent at least 3 independent experiments. (C) HEK 293T and HeLa cells were co-transfected with LLO-Myc tag and Ap2a2-HA tag plasmids. At 24 hours post transfection, cells were permeabilized and stained with anti-Myc (red), anti-HA antibodies (Green), and nuclear dye DAPI (blue). Scale bars are 10 μm. (B) Co-immunoprecipitation of Ap2a2 from transfected HEK293T cells using an anti-Myc-LLO antibody. Results shown represent 3 independent experiments. See also Figure S3.

Article Snippet: Ap2a2 CRISPR guide sgRNA 2 , TCACCTGACCTAGTTCCCAT , Broad institute GPP Web Portal https://portals.broadinstitute.org/gpp/public/analysis-tools/sgrna-design.

Techniques: Construct, Y2H Assay, Activity Assay, Positive Control, Transfection, Staining, Immunoprecipitation

Journal: Cell host & microbe

Article Title: The Listeriolysin O PEST-like Sequence Co-opts AP-2-Mediated Endocytosis to Prevent Plasma Membrane Damage during Listeria Infection

doi: 10.1016/j.chom.2018.05.006

Figure Lengend Snippet: (A) The intracellular growth of the wild type 10403S strain and the L. monocytogenes-LLO L461T strain in BMMs with the CRISPR/Cas9-mediated Ap2a2 knockout and sgRNA control BMMs. 50μg/ml gentamicin was added after 1h to kill extracellular bacteria. Results shown represent at least 3 independent experiments. (B) Schematic of hlyfl L. monocytogenes strain. The hly and tetL (tetracycline resistance) genes are flanked by loxP sites. Cre recombinase is expressed from the cytosol-specific actA promoter. Recombination between loxP sites leads to the excision of the DNA encoding hly and tetL. (C) Intracellular growth of the hlyfl L. monocytogenes strain in Ap2a2 knockout and control BMMs. 50μg/ml gentamicin was added to kill extracellular L. monocytogenes. Results are representative of at least 3 independent experiments. (D) Flow cytometry analysis of SYTOX Blue staining of control and Ap2a2 knockdown BMM infected for 8 hours with an effective MOI of 1. Positively stained cells resulted from the loss of plasma membrane integrity. No gentamicin was added for plasma membrane integrity assay. ** p<0.01, *** p<0.001 (Student’s t-test). Results shown represent 2 independent experiments. See also Figure S4.

Article Snippet: Ap2a2 CRISPR guide sgRNA 2 , TCACCTGACCTAGTTCCCAT , Broad institute GPP Web Portal https://portals.broadinstitute.org/gpp/public/analysis-tools/sgrna-design.

Techniques: CRISPR, Knock-Out, Control, Bacteria, Flow Cytometry, Staining, Knockdown, Infection, Clinical Proteomics, Membrane, Integrity Assay

Journal: Cell host & microbe

Article Title: The Listeriolysin O PEST-like Sequence Co-opts AP-2-Mediated Endocytosis to Prevent Plasma Membrane Damage during Listeria Infection

doi: 10.1016/j.chom.2018.05.006

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: Ap2a2 CRISPR guide sgRNA 2 , TCACCTGACCTAGTTCCCAT , Broad institute GPP Web Portal https://portals.broadinstitute.org/gpp/public/analysis-tools/sgrna-design.

Techniques: Virus, Recombinant, Staining, Flow Cytometry, Modification, Lysis, Transfection, Immunoprecipitation, Plasmid Preparation, CRISPR, Software, Microscopy

Journal: Cell Genomics

Article Title: Recurrent breakpoints in the BRD4 locus reduce toxicity associated with gene amplification

doi: 10.1016/j.xgen.2025.100815

Figure Lengend Snippet: Use of CRISPR-Cas9 technology to mimic the effect of BRD4 focal deletions (A) Confirmation of Cas9 expression in OVSAHO cells by immunoblotting. (B) Fraction of GFP + cells detected in Cas9 activity assay. To measure Cas9 cutting efficiency, OVSAHO-Cas9 cells were transduced with a vector encoding GFP and sgGFP. After 10 days, a decreased population of GFP + cells was detected by flow cytometry, confirming Cas9 activity. (C) Intronic BRD4 regions targeted by CRISPR-Cas9 sgRNAs (inset not to scale due to length of intron 1). (D) CRISPR sequencing results for sgBRD4_region1 and sgBRD4_region2, showing the percentage of uncut, frameshift, and in-frame BRD4 reads when aligned to a reference sequence. (E) Expression of BRD4 isoforms following CRISPR-Cas9-mediated sgRNA cutting, relative to sgGFP control. Median and standard deviations of three replicates, two-way ANOVA. (F) Quantification of cell confluency in OVSAHO-Cas9 cells following CRISPR-Cas9-mediated sgRNA cutting of BRD4 regulatory regions or sgGFP control. Mean and standard deviation of three replicates, two-way ANOVA followed by Dunnett post-tests, controlling the Family-wise alpha threshold and confidence level. p values of the final time point are annotated. (G) Landscape of BRD4 dependency across ovarian cancers. Chronos scores (with mean and standard deviation) are shown for every ovarian cancer cell line included in the DepMap Public 23Q4 release. A score of −1 (median score for essential genes; red dashed line) is used as reference to indicate genetic dependency.

Article Snippet: The lentiviral vectors pXPR_BRD111 and pXPR_BRD016 expressing human SpCas9 and a single-guide RNA (sgRNA) of interest, respectively, were acquired from the GPP Platform (Broad Institute of MIT and Harvard).

Techniques: CRISPR, Expressing, Western Blot, Activity Assay, Transduction, Plasmid Preparation, Flow Cytometry, Sequencing, Control, Standard Deviation

Journal: Cell Genomics

Article Title: Recurrent breakpoints in the BRD4 locus reduce toxicity associated with gene amplification

doi: 10.1016/j.xgen.2025.100815

Figure Lengend Snippet:

Article Snippet: The lentiviral vectors pXPR_BRD111 and pXPR_BRD016 expressing human SpCas9 and a single-guide RNA (sgRNA) of interest, respectively, were acquired from the GPP Platform (Broad Institute of MIT and Harvard).

Techniques: Virus, Expressing, Recombinant, Plasmid Preparation, Transfection, cDNA Synthesis, Bicinchoninic Acid Protein Assay, Software, CRISPR, Amplification, Sequencing

Journal: Fishes

Article Title: Editing the Melanocortin-4 Receptor Gene in Channel Catfish Using the CRISPR-Cas9 System

doi: 10.3390/fishes8020116

Figure Lengend Snippet: Figure 5. Embryo survival, hatchability, and fry survival curves of channel catfish, Ictalurus punctatus, embryos from the Kansas random strain microinjected at the one-cell stage with sgRNAs/Cas9 protein targeting the melanocortin-4 receptor (mc4r) gene. Three gRNAs were microinjected individually (MC4RA, MC4RB, and MC4RC) or multiplexed (MC4RMIX). Two control treatments were used. Injected control embryos (iCTRL) were full-sib to the treatment groups and injected with the same solution and volume, but without sgRNA or Cas9 protein. The second control was not injected (nCTRL). (A) Embryo cumulative survival was considered 100% at day 0 then decreased over time as embryos died. (B) The hatch rate was calculated as the fraction of embryos that hatched at a given time point compared to the total live embryos that hatched. (C) Fry survival was calculated for the fry just after hatching and until 20 days post fertilization (dpf).

Article Snippet: Design of the CRISPR-Cas9 System Small guided RNAs (sgRNA) were designed (Table 1) and cloned into a pU6dsgRNA (No. 5) plasmid [42] from Addgene (Cambridge, MA, USA).

Techniques: Control, Injection

Journal: Fishes

Article Title: Editing the Melanocortin-4 Receptor Gene in Channel Catfish Using the CRISPR-Cas9 System

doi: 10.3390/fishes8020116

Figure Lengend Snippet: Figure 6. CRISPR-Cas9-induced mutagenesis in the melanocortin-4 receptor (mc4r) gene of channel catfish, Ictalurus punctatus, Kansas random strain through microinjection of guide RNAs and Cas9 enzyme. The partial sequence of wild-type channel catfish mc4r gene (WT) is the top sequence in each panel. Sequences in green and blue colors are the target sites of the sgRNAs followed by the protospacer-adjacent motif (PAM) sequence, respectively. Red arrows indicate the expected sites of cleavage by Cas9. Dashes indicate the deletion of nucleotides along the mc4r gene. The plus (+) and minus (−) signs indicate insertions and deletions, respectively. (A) MC4RA treatment, (B) MC4RB treatment, (C) MC4RC treatment, and (D) MC4RMIX treatment.

Article Snippet: Design of the CRISPR-Cas9 System Small guided RNAs (sgRNA) were designed (Table 1) and cloned into a pU6dsgRNA (No. 5) plasmid [42] from Addgene (Cambridge, MA, USA).

Techniques: CRISPR, Mutagenesis, Microinjection, Sequencing

Journal: Molecular Therapy. Nucleic Acids

Article Title: Targeting the IGF1R Pathway in Breast Cancer Using Antisense lncRNA-Mediated Promoter cis Competition

doi: 10.1016/j.omtn.2018.04.013

Figure Lengend Snippet: Targeting the IGF1R Pathway by Antisense lncRNA IRAIN -Mediated cis Competition (A) The orientation of IGF1R and IRAIN . The antisense IRAIN lncRNA is transcribed from an intronic promoter of the IGF1R gene. (B) Schematic diagram of the antisense lncRNA-mediated cis competition in the IGF1R signaling pathway. In normal tissues, the transcription of the IGF1R / IRAIN locus is balanced. In breast cancer cells, however, IGF1R is upregulated while IRAIN is downregulated. This unbalanced expression leads to increased activation of the IGF1R signaling pathway. An ALIC targeting approach is used to reverse this unbalance. A strong CMV promoter is inserted in front of the IRAIN lncRNA to induce increased production of IRAIN , which then competes in cis with the overlapping IGF1R promoter and dampens the IGF1R signaling pathway in tumor cells. This provides a molecular basis for the development of the precision therapy against breast cancer. (C) ALIC targeting of IGF1R by CRISPR Cas9-guided recombinant knockin. Cas9, CRISPR Cas9; gRNA, Cas9 guiding RNA; pCMV, CMV promoter; pH1, RNA polymerase III H1 promoter; Cre, Cre recombinase; pA, SV40 poly(A) signal; loxP, the locus of X-over P1 recombination site recognized by Cre; Arm 1-2, the genomic sequences used for recombination. Under the guidance of gRNAs, Cas9-mediated genomic recombination at the IRAIN locus, resulting in the insertion of the CMV promoter-puro cassette in front of the IRAIN . After puromycin selection, the cells were treated with Cre to remove the selection marker Puro + . In the selected cell clones, IRAIN is under the control of the strong promoter pCMV. The upregulated transcription of this antisense lncRNA will compete in cis with that of the sense IGF1R mRNA. (D) Initial screening of targeted cell clones by PCR. Primers were designed from the IRAIN arm, selection marker, and vector sequences. PCR was used to identify the wild-type, targeted DNA, and vector DNAs. RIC, control cells that were generated in parallel with ALIC targeting by transfecting the cells with only the donor vector DNA and selected with puromycin. As the control, RIC cells carry the randomly inserted donor vector DNA. Clones 1–12, cell clones that were generated by co-transfection with Cas9 target vector-donor vector DNAs and selected by both puromycin and ganciclovir. Targeting cell clones not only carry the IGF1R targeting allele, but also contain some amount of the randomly inserted donor vector DNA in the genome. Among them, clone 7 contains a minimum amount of randomly inserted vector DNA and was thus used for subsequent studies.

Article Snippet: We constructed the Cas9- IRAIN -gRNA-targeting vector by cloning two IRAIN promoter gRNAs into the lenti-CRISPR-EGFP-gRNA vector (Addgene Plasmid #51761).

Techniques: Expressing, Activation Assay, CRISPR, Recombinant, Knock-In, Genomic Sequencing, Selection, Marker, Clone Assay, Plasmid Preparation, Generated, Cotransfection